JBRA Assist. Reprod. 2020;24(4):447-453
ORIGINAL ARTICLE
doi: 10.5935/1518-0557.20200027
GDF9 polymorphisms: influence on ovarian response in women undergoing controlled ovarian hyperstimulation
1Department of Obstetrics and Gynecology, Universidade Federal do Pará, Belém, PA, Brazil
2Clinica de reprodução assistida Pronatus, Belém, PA, Brazil
33Programa de Pós-Graduação de Ciências Médicas da Universidade Federal do Rio Grande do Sul, Porto Alegre,
RS, Brazi
4Clínica Insemine de Medicina Reprodutiva, Porto Alegre, RS, Brazil
The authors have no conflict of interest to declare.
ABSTRACT
Objective: The study looked into the possible influence of GDF9 polymorphisms on ovarian
response in women with a normal ovarian reserve undergoing controlled
ovarian hyperstimulation for in vitro fertilization (IVF).
Methods: This cross-sectional study included 67 women with normal ovarian reserve aged
30-39 years submitted to controlled ovarian hyperstimulation for IVF. We
sequenced four polymorphisms in the GDF9 gene (C398G, C447T, G546A, and
G646A) and analyzed their influence on follicular and oocyte outcomes.
Results: The mutant allele C398G decreased the total number of follicles >17mm
(6.49 vs. 4.33, p=0.001), total number of
follicles (10.11 vs. 7.33, p=0.032),
number of MII oocytes retrieved, and serum progesterone levels on trigger
day. The C447T polymorphism was associated with a greater number of
follicles between 12 and 14 mm on the day of r-hCG, while the G546A
polymorphism was associated with lower serum progesterone levels on trigger
day.
Conclusions: GDF9 gene polymorphisms C398G and C447T adversely affected ovarian response
in women undergoing controlled ovarian hyperstimulation. These findings show
that in addition to playing a role in the early stages of folliculogenesis,
GDF9 polymorphisms have an important impact on the final stage of oocyte
development.
Keywords: GDF9, polymorphism, in vitro fertilization, oocyte, follicle retrieval
INTRODUCTION
In vitro fertilization is an efficient assisted reproduction
technology used to treat infertility in women. One of the essential elements in
successful IVF is the number of eggs produced following controlled ovarian
hyperstimulation (COH) (van Loendersloot et
al., 2014). Several factors regulate follicular growth and
depletion; these include members of the transforming growth factor-β (TGFB)
super family (Knight & Glister, 2006; Trombly et al., 2009; Pangas, 2012). GDF-9, a member of TGFB
super family, is an oocyte-derived factor that is preferentially expressed in the
oocytes of humans and mice (Chang et
al., 2016) known to influence follicle growth and depletion
rates (Simoni et al., 2008; Knight & Glister, 2006; Juengel & McNatty, 2005; Broekmans et al., 2009). GDF-9
genetic variants have been associated with abnormal follicular loss and potential
premature ovarian failure (POF) (Broekmans et
al., 2009).
GDF-9 contributes to ovarian folliculogenesis, a process that controls various
granulosa cell processes and the ovulation rate. GDF-9 supports the proliferation of
granulosa cells and the growth of cumulus cells, the halt of follicular apoptosis,
and the growth of oocytes and embryos (Vitt et al., 2000; Yan et al., 2001; Orisaka et al., 2006; Yeo et al., 2008). Additionally, GDF9 stimulates
granulosa cell proliferation (Vitt et
al., 2000) and cumulus expansion (Yan et al., 2001), inhibits follicular
apoptosis (Orisaka et al.,
2006), and enhances oocyte and embryo development (Yeo et al., 2008; Hussein et al., 2006). Taken together, these
findings suggest that disrupting the GDF9 gene may prevent folliculogenesis and
oogenesis, resulting in ovarian failure. Consistent with these results, GDF9
mutations have been related to abnormal reproductive phenotypes in women, including
POF (Hanrahan et al., 2004; Dixit et al., 2005; Chand et al., 2006), polycystic
ovary syndrome (Sun et al.,
2010; Wei et al.,
2014), and dizygotic twinning (Palmer et al., 2006).
Single nucleotide polymorphisms (SNPs) of GDF-9 have been correlated with POF,
suggesting that these variants may contribute to aberrant follicular development and
oocyte loss (Chand et al.,
2006; Laissue et al.,
2006; Kovanci et al.,
2007). Among the SNPs in the GDF9 gene that have been associated with
infertility and POF (Kovanci et
al., 2007), the most notable are C398-9G (Dixit et al., 2005), C447T (Dixit et al., 2005, Serdyńska-Szuster et al.,
2016), G546A (Serdyńska-Szuster et
al., 2016; Wang et
al., 2010), and G646A (Dixit et al., 2005). Few studies regarding the association
between GDF9 polymorphisms and controlled ovarian hyperstimulation (COH) outcomes
have been published (Wang et al.,
2010; 2013). The aim of this study
was to investigate the possible influence of GDF9 polymorphisms (C398G, C477T,
G546A, and G646A) on ovarian response in women with a normal ovarian reserve
undergoing COH for IVF.
MATERIALS AND METHODS
This cross-sectional study included women aged 30-39 years undergoing COH based on an
r-FSH and r-GnRH antagonist protocol sequenced for four polymorphisms of the GDF-9
gene (C398-9G, C447T, G546A and G646A). The study was carried out at the Pronatus
Assisted Reproduction Center and at the Federal University of Rio Grande do Sul. The
National Committee for Ethics and Research with Human Beings and the Ethics
Committee of the Hospital de Clínicas de Porto Alegre approved the study and
assigned it certificate no. 25525413.0.0000.5327 (Institutional Review Board
equivalent).
A total of 67 women were included in the study. Since the study aimed to evaluate
women with a normal ovarian reserve (NOR), the following inclusion criteria were
used: age between 30 and 39 years, normal ovarian reserve (antral follicle count
>5 (Broer et al., 2011),
AMH >1.0ng/mL (Tal & Seifer, 2017) and
FSH <8IU/L at 3rd of menstrual cycle (27), regular cycles, a diagnosis
of infertility (more than one year) by tubal factor (confirmed by
hysterosalpingography or videolaparoscopy) or by severe male factor (spermogram of
<5 million sperm/ml). The following exclusion criteria were applied: polycystic
ovary syndrome, presence of only one ovary or other previous ovarian surgery,
previous chemotherapy or endometrioma. All patients were evaluated for ovarian
reserve on the third day of the menstrual cycle based on antral follicle count (AFC)
and FSH, LH, AMH, and E2 levels.
Ovarian stimulation was initiated on the third day of the menstrual cycle with
recombinant FSH (Puregon, Organon) and included r-FSH 200 IU/day for the first three
days and then 150 IU/day; after Day 6, a GnRH antagonist, Orgalutran (Organon), was
administered daily by S.C. (0.25mg/d) until the administration of recombinant human
chorionic gonadotropin (rhCG) (Ovidrel 250 mg/0.5ml, Serono). When the majority of
the follicles reached 17 mm, oocyte maturation was stimulated with recombinant hCG
and on this day all follicles were measured and serum FSH, LH and P4 levels were measured. Ultrasound-guided oocyte retrieval was performed after 35 h
and, following denudation, the oocytes were categorized as metaphase II (MII),
metaphase I (MI), or prophase I (PI) stage.
Whole blood samples were collected and aliquots of 350 µL from each sample
were used for genomic DNA extraction using the Easy DNA kit according to
manufacturer’s instructions (Invitrogen, UK). For analysis of the GDF-9 gene, the
first portion of exon 2 was amplified by polymerase chain reaction (PCR) using the
forward (5′ TTGACTTGACTGCCTGTTGTG 3′) and reverse primers (5′ AGCCTGAGCACTTGTGTCATT
3′) described by Kovanci et al.
(2007) at an annealing temperature of 63°C. The DNA concentration used
was 200 ng/µL (the product obtained was a 491-bp fragment). Amplification was
performed using the Veriti® 96-Well Thermal Cycler (Applied Biosystems, USA)
with reagents from Invitrogen (UK) and was confirmed by electrophoresis on 1.5%
agarose gel. The 491-bp fragments were purified with PEG8000 and NaCl 2.5 M, and the
samples were sequenced according to the Sanger method using an ABI 3500 Genetic
Analyzer automated sequencer (Applied Biosystems, USA). The reverse primer was used
for sequencing at a concentration of 4 pmol/µL, and the results were compared
to the reference sequence from NCBI (NM_005260.3).
Observed numbers for each genotype studied (C398-9G, C447T, G546A, and G646A) were
compared with expected values to test whether the sample was in the Hardy-Weinberg
equilibrium. Data were tested for normality using the Kolmogorov-Smirnov test.
Differences between groups for data with a normal distribution were evaluated with
the t-test or one-way analysis of variance (ANOVA) and the Bonferroni post-hoc test
when indicated. The Mann-Whitney and Kruskal-Wallis tests were used in the analysis
of non-parametric data. Qualitative variables were analyzed with the Chi-square
test. Statistical significance was set at <0.05. Statistical tests were performed
with the Statistical Package for the Social Sciences 23 (SPSS Inc., Chicago,
IL).
RESULTS
Demographic and clinical characteristics of the women included in the study are shown
in Table 1. Their mean age was 35.3 years (SD
3.83) and they had been diagnosed with infertility for 4.2 years (SD 3.2). The
Hardy-Weinberg equilibrium test results using the chi-square test for GDF9
polymorphisms were as follows: p=0.51 for C398G, p=0.33 for C447T, and p=0.74 for G546A; the women
included in the study were homozygous for wild-type (GG) at position 649.
Table 1. Demographic and clinical characteristics of women undergoing IVF
The influence of the C398G polymorphism in patients undergoing IVF is shown in Table 2 (two patients were excluded due to polymorphism sequencing failure). The presence of the mutant allele (C398G) was associated with a reduction in the total number of follicles >17mm on trigger day (6.49 vs. 4.33, p=0.001), a lower number of follicles (10.11 vs. 7.33, p=0.032), a lower number of MII oocytes retrieved (8.84 vs. 5.38, p=0.017), and lower serum progesterone levels on trigger day (0.96 vs. 0.47, p=0.003).
Table 2. Influence of the C398G polymorphism of the GDF-9 gene in patients undergoing
IVF
The results from the evaluation of the effects of C447T polymorphism in patients undergoing IVF are shown in Table 3 (one patient was excluded due to polymorphism sequencing failure). The presence of the mutant allele C447T significantly increased the number of follicles measuring 12-14 mm on trigger day (1.62 vs. 2.46, p=0.007).
Table 3. Influence of the C447T polymorphism of the GDF-9 gene in patients undergoing
IVF
The influence of the G546A polymorphism in patients undergoing IVF is shown in Table 4. The presence of the mutant allele G546A decreased serum progesterone levels on trigger day (0.92 vs. 0.53, p=0.025).
Table 4. Influence of the G546A polymorphism of the GDF-9 gene in patients undergoing
IVF
DISCUSSION
Previous studies have described the negative impacts of GDF9 polymorphisms on ovarian
reserve leading to POF (Dixit et
al., 2005; Chand et
al., 2006). Since the present study included only patients
with a normal ovarian reserve, it provided insight into the effects of GDF-9
polymorphisms on ovarian response to COH in these patients. In other words, it
looked into whether these polymorphisms influence not only the ovarian reserve as
previously described, but follicular growth as well. We found that the presence of
some of the analyzed polymorphisms influenced follicular development or hormone
production in some way. The presence of the C398G polymorphism was associated with a
lower number of retrieved MII oocytes (8.8 versus 5.3), a lower
number of total follicles on trigger day (10.1 versus 7.3), and
lower levels of serum progesterone on trigger day (0.9 versus 0.4).
The C447T polymorphism was associated with a greater number of follicles between 12
and 14 mm (1.6 versus 2.40), indicating it may impair follicular
growth. The G546A polymorphism, such as C398G, has also been associated with lower
levels of serum progesterone on trigger day (0.92 versus 0.53).
In vitro studies using recombinant GDF9 protein have clarified the
biological roles and importance of GDF9 activity in follicle growth and development
in all stages of folliculogenesis. In the preantral stage, GDF9 has been shown to
stimulate the growth of in vitro cultured preantral follicles
(Hayashi et al., 1999)
and to promote growth of early-preantral follicles in human ovaries (Hreinsson et al., 2002). In
the transition to the antral stage, it appears that GDF9 promotes follicular
survival by suppressing granulosa cell apoptosis and follicular atresia (Orisaka et al., 2006). This
may be achieved in part by GDF9 stimulating the expression of follicular FSH
receptor (FSHR), since adequate FSHR levels in granulosa cells are essential for
FSH-dependent antral-follicle growth. These mechanisms explain why the presence of
some GDF-9 polymorphisms may influence the ovarian reserve, since they have been
associated with diminished ovarian reserve (DOR), poor response after ovarian
stimulation, and poor IVF outcome in studies comparing women with infertility and
females with a normal ovarian reserve (Wang et al., 2010; 2013; Greene et al.,
2014).
Published data further reinforce the findings of our study. GDF-9 has a role not only
in follicular recruitment, but also in the entire process from follicle recruitment
to oocyte maturation. We evaluated women with a normal ovarian reserve and no
differences in the number of antral follicles; however, the presence of some GDF-9
polymorphisms resulted in altered follicular growth (C447T and C398G) and culminated
in fewer retrieved MII oocytes (C398G) and fewer antral follicles.
Studies have demonstrated that many intra- and extra-ovarian factors, including FSH,
LH and E2, play important roles in the development of follicles; however,
paracrine signals derived from oocytes, including GDF9, seem to be the predominant
determinants of the developmental state of follicles (Wei et al., 2014; Emori & Sugiura, 2014; Li et al., 2014). Prior to the LH surge, cumulus cells
require GDF9 to support metabolic cascades, such as glycolysis and sterol
biosynthesis (Sugiura et al.,
2005). GDF9 also regulates diverse processes and gene expression during
the preovulatory stage (Elvin et
al., 2000) and enhances cumulus cell expansion in the presence
of FSH (Elvin et al., 1999),
but not in the absence of FSH (Dragovic et
al., 2005). Beyond that, GDF-9 induces an EP2 signal
transduction pathway, which appears to be required for progesterone synthesis in
cumulus granulosa cells (Elvin et
al., 2000). These mechanisms may explain the reason for the
decrease in serum progesterone levels associated with the C447T and G546A
polymorphisms. Failure of these mechanisms may decrease serum progesterone
production, and cause or reflect failures in maturation and oocyte quality.
Importantly, the present study showed a negative association between GDF9
polymorphisms and follicular development in women with a normal ovarian reserve
undergoing COH for IVF in an ethnically heterogeneous population. The findings
suggested that GDF9 polymorphisms might be used as biomarkers in patients undergoing
ovarian COH, since even in patients with a normal ovarian reserve the presence of
these polymorphisms indicates a worse prognosis for COH. Additionally, women under
gestational counseling may be advised to anticipate pregnancy if have these
polymorphisms, since they may suffer with early ovarian reserve decreases.
CONCLUSION
We concluded that GDF9 gene polymorphisms (C398G, C477T, G546A) adversely affect
ovarian response in women with a normal ovarian reserve undergoing COH for IVF. The
presence of the C398G polymorphism was associated with a lower number of retrieved
MII oocytes and a lower number of total follicles on r-hCG day. The C447T
polymorphism was associated with a greater number of follicles between 12 and 14mm
on the day of r-hCG, while the C398G and G546A polymorphisms were associated with
lower levels of serum progesterone on r-hCG day. These data show that this member of
the TGFB family functions in the early stages of folliculogenesis, causing DOR, and
exerts an important influence on the final stage of oocyte development, even in
patients with a normal ovarian reserve.
ACKNOWLEDGEMENT
We are grateful for the financial support provided by the Fundo de Incentivo à
Pesquisa (FIPE), Hospital de Clínicas de Porto Alegre, Brazil.
REFERENCES
Broekmans FJ, Soules MR, Fauser BC. Ovarian aging: mechanisms and
clinical consequences. Endocr Rev. 2009;30:465-93. PMID: 19589949 DOI:
10.1210/er.2009-0006
Medline Crossref
Broer SL, Dólleman M, Opmeer BC, Fauser BC, Mol BW, Broekmans FJ.
AMH and AFC as predictors of excessive response in controlled ovarian
hyperstimulation: a meta-analysis. Hum Reprod Update. 2011;17:46-54. PMID:
20667894 DOI: 10.1093/humupd/dmq034
Medline Crossref
Chand AL, Ponnampalam AP, Harris SE, Winship IM, Shelling AN.
Mutational analysis of BMP15 and GDF9 as candidate genes for premature ovarian
failure. Fertil Steril. 2006;86:1009-12. PMID: 17027369 DOI:
10.1016/j.fertnstert.2006.02.107
Medline Crossref
Chang HM, Qiao J, Leung PC. Oocyte-somatic cell interactions in the
human ovary-novel role of bone morphogenetic proteins and growth differentiation
factors. Hum Reprod Update. 2016;23:1-18. PMID: 27797914 DOI:
10.1093/humupd/dmw039
Medline Crossref
Dixit H, Rao LK, Padmalatha V, Kanakavalli M, Deenadayal M, Gupta N,
Chakravarty B, Singh L. Mutational screening of the coding region of growth
differentiation factor 9 gene in Indian women with ovarian failure. Menopause.
2005;12:749-54. PMID: 16278619 DOI:
10.1097/01.gme.0000184424.96437.7a
Medline Crossref
Dragovic RA, Ritter LJ, Schulz SJ, Amato F, Armstrong DT, Gilchrist
RB. Role of oocyte-secreted growth differentiation factor 9 in the regulation of
mouse cumulus expansion. Endocrinology. 2005;146:2798-806. PMID: 15761035 DOI:
10.1210/en.2005-0098
Medline Crossref
Elvin JA, Yan C, Wang P, Nishimori K, Matzuk MM. Molecular
characterization of the follicle defects in the growth differentiation factor
9-deficient ovary. Mol Endocrinol. 1999;13:1018-34. PMID: 10379899 DOI:
10.1210/mend.13.6.0309
Medline Crossref
Elvin JA, Yan C, Matzuk MM. Growth differentiation factor-9
stimulates progesterone synthesis in granulosa cells via a prostaglandin E2/EP2
receptor pathway. Proc Natl Acad Sci U S A. 2000;97:10288-93. PMID: 10944203
DOI: 10.1073/pnas.180295197
Medline Crossref
Emori C, Sugiura K. Role of oocyte-derived paracrine factors in
follicular development. Anim Sci J. 2014; 85:627-33. PMID: 24717179 DOI:
10.1111/asj.12200
Medline Crossref
Greene AD, Patounakis G, Segars JH. Genetic associations with
diminished ovarian reserve: a systematic review of the literature. J Assist
Reprod Genet. 2014;31:935-46. PMID: 24840722 DOI:
10.1007/s10815-014-0257-5
Medline Crossref
Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R,
Galloway SM. Mutations in the genes for oocyte-derived growth factors GDF9 and
BMP15 are associated with both increased ovulation rate and sterility in
Cambridge and Belclare sheep (Ovis aries). Biol Reprod. 2004;70:900-9. PMID:
14627550 DOI: 10.1095/biolreprod.103.023093
Medline Crossref
Hayashi M, McGee EA, Min G, Klein C, Rose UM, van Duin M, Hsueh AJ.
Recombinant growth differentiation factor-9 (GDF-9) enhances growth and
differentiation of cultured early ovarian follicles. Endocrinology.
1999;140:1236-44. PMID: 10067849 DOI: 10.1210/endo.140.3.6548
Medline Crossref
Hreinsson JG, Scott JE, Rasmussen C, Swahn ML, Hsueh AJ, Hovatta O.
Growth differentiation factor-9 promotes the growth, development, and survival
of human ovarian follicles in organ culture. J Clin Endocrinol Metab.
2002;87:316-21. PMID: 11788667 DOI: 10.1210/jcem.87.1.8185
Medline Crossref
Hussein TS, Thompson JG, Gilchrist RB. Oocyte-secreted factors
enhance oocyte developmental competence. Dev Biol. 2006;296:514-21. PMID:
16854407 DOI: 10.1016/j.ydbio.2006.06.026
Medline Crossref
Juengel JL, McNatty KP. The role of proteins of the transforming
growth factor-beta superfamily in the intraovarian regulation of follicular
development. Hum Reprod Update. 2005;11:143-60. PMID: 15705960 DOI:
10.1093/humupd/dmh061
Medline Crossref
Knight PG, Glister C. TGF-beta superfamily members and ovarian
follicle development. Reproduction. 2006;132:191-206. PMID: 16885529 DOI:
10.1530/rep.1.01074
Medline Crossref
Kovanci E, Rohozinski J, Simpson JL, Heard MJ, Bishop CE, Carson SA.
Growth differentiating factor-9 mutations may be associated with premature
ovarian failure. Fertil Steril. 2007;87:143-6. PMID: 17156781 DOI:
10.1016/j.fertnstert.2006.05.079
Medline Crossref
Laissue P, Christin-Maitre S, Touraine P, Kuttenn F, Ritvos O,
Aittomaki K, Bourcigaux N, Jacquesson L, Bouchard P, Frydman R, Dewailly D,
Reyss AC, Jeffery L, Bachelot A, Massin N, Fellous M, Veitia RA. Mutations and
sequence variants in GDF9 and BMP15 in patients with premature ovarian failure.
Eur J Endocrinol. 2006;154:739-44. PMID: 16645022 DOI:
10.1530/eje.1.02135
Medline Crossref
Li Y, Li RQ, Ou SB, Zhang NF, Ren L, Wei LN, Zhang QX, Yang DZ.
Increased GDF9 and BMP15 mRNA levels in cumulus granulosa cells correlate with
oocyte maturation, fertilization, and embryo quality in humans. Reprod Biol
Endocrinol. 2014;12:81. PMID: 25139161 DOI:
10.1186/1477-7827-12-81
Medline Crossref
Orisaka M, Orisaka S, Jiang JY, Craig J, Wang Y, Kotsuji F, Tsang
BK. Growth differentiation factor 9 is antiapoptotic during follicular
development from preantral to early antral stage. Mol Endocrinol.
2006;20:2456-68. PMID: 16740654 DOI: 10.1210/me.2005-0357
Medline Crossref
Palmer JS, Zhao ZZ, Hoekstra C, Hayward NK, Webb PM, Whiteman DC,
Martin NG, Boomsma DI, Duffy DL, Montgomery GW. Novel variants in growth
differentiation factor 9 in mothers of dizygotic twins. J Clin Endocrinol Metab.
2006;91:4713-6. PMID: 16954162 DOI: 10.1210/jc.2006-0970
Medline Crossref
Pangas SA. Regulation of the ovarian reserve by members of the
transforming growth factor beta family. Mol Reprod Dev. 2012;79:666-79. PMID:
22847922 DOI: 10.1002/mrd.22076
Medline Crossref
Serdyńska-Szuster M, Jędrzejczak P, Ożegowska KE, Hołysz H,
Pawelczyk L, Jagodziński PP. Effect of growth differentiation factor-9 C447T and
G546A polymorphisms on the outcomes of in vitro fertilization. Mol Med Rep.
2016;13:4437-42. PMID: 27035733 DOI: 10.3892/mmr.2016.5060
Medline Crossref
Simoni M, Tempfer CB, Destenaves B, Fauser BC. Functional genetic
polymorphisms and female reproductive disorders: Part I: Polycystic ovary
syndrome and ovarian response. Hum Reprod Update. 2008;14:459-84. PMID: 18603647
DOI: 10.1093/humupd/dmn024
Medline Crossref
Sugiura K, Pendola FL, Eppig JJ. Oocyte control of metabolic
cooperativity between oocytes and companion granulosa cells: energy metabolism.
Dev Biol. 2005;279:20-30. PMID: 15708555 DOI:
10.1016/j.ydbio.2004.11.027
Medline Crossref
Sun RZ, Lei L, Cheng L, Jin ZF, Zu SJ, Shan ZY, Wang ZD, Zhang JX,
Liu ZH. Expression of GDF-9, BMP-15 and their receptors in mammalian ovary
follicles. J Mol Histol. 2010;41:325-32. PMID: 20857181 DOI:
10.1007/s10735-010-9294-2
Medline Crossref
Tal R, Seifer DB. Ovarian reserve testing: a user's guide. Am J
Obstet Gynecol. 2017;217:129-40. PMID: 28235465 DOI:
10.1016/j.ajog.2017.02.027
Medline Crossref
Trombly DJ, Woodruff TK, Mayo KE. Roles for transforming growth
factor beta superfamily proteins in early folliculogenesis. Semin Reprod Med.
2009;27:14-23. PMID: 19197801 DOI: 10.1055/s-0028-1108006
Medline Crossref
van Loendersloot L, Repping S, Bossuyt PM, van der Veen F, van Wely
M. Prediction models in in vitro fertilization; where are we? A mini review. J
Adv Res. 2014;5:295-301. PMID: 25685496 DOI:
10.1016/j.jare.2013.05.002
Medline Crossref
Vitt UA, Hayashi M, Klein C, Hsueh AJ. Growth differentiation
factor-9 stimulates proliferation but suppresses the follicle-stimulating
hormone-induced differentiation of cultured granulosa cells from small antral
and preovulatory rat follicles. Biol Reprod. 2000;62:370-7. PMID: 10642575 DOI:
10.1095/biolreprod62.2.370
Medline Crossref
Wang TT, Wu YT, Dong MY, Sheng JZ, Leung PC, Huang HF. G546A
polymorphism of growth differentiation factor-9 contributes to the poor outcome
of ovarian stimulation in women with diminished ovarian reserve. Fertil Steril.
2010;94:2490-2. PMID: 20451184 DOI:
10.1016/j.fertnstert.2010.03.070
Medline Crossref
Wang TT, Ke ZH, Song Y, Chen LT, Chen XJ, Feng C, Zhang D, Zhang RJ,
Wu YT, Zhang Y, Sheng JZ, Huang HF. Identification of a mutation in GDF9 as a
novel cause of diminished ovarian reserve in young women. Hum Reprod.
2013;28:2473-81. PMID: 23851219 DOI: 10.1093/humrep/det291
Medline Crossref
Wei LN, Huang R, Li LL, Fang C, Li Y, Liang XY. Reduced and delayed
expression of GDF9 and BMP15 in ovarian tissues from women with polycystic ovary
syndrome. J Assist Reprod Genet. 2014;31:1483-90. PMID: 25172094 DOI:
10.1007/s10815-014-0319-8
Medline Crossref
Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV,
Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM. Synergistic roles of bone
morphogenetic protein 15 and growth differentiation factor 9 in ovarian
function. Mol Endocrinol. 2001;15:854-66. PMID: 11376106 DOI:
10.1210/mend.15.6.0662
Medline Crossref
Yeo CX, Gilchrist RB, Thompson JG, Lane M. Exogenous growth
differentiation factor 9 in oocyte maturation media enhances subsequent embryo
development and fetal viability in mice. Hum Reprod. 2008;23:67-73. PMID:
17933754 DOI: 10.1093/humrep/dem140
Medline Crossref