JBRA Assist. Reprod. 2020;24(4):447-453
ORIGINAL ARTICLE

doi: 10.5935/1518-0557.20200027

GDF9 polymorphisms: influence on ovarian response in women undergoing controlled ovarian hyperstimulation

João Paolo Bilibio1,2,3, Arivaldo José Conceição Meireles2,3, Emily De Conto3,4, Panila Longhi Lorenzzoni2, Fábio Costa do Nascimento2, João Sabino da Cunha-Filho3,4

1Department of Obstetrics and Gynecology, Universidade Federal do Pará, Belém, PA, Brazil
2Clinica de reprodução assistida Pronatus, Belém, PA, Brazil
33Programa de Pós-Graduação de Ciências Médicas da Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazi
4Clínica Insemine de Medicina Reprodutiva, Porto Alegre, RS, Brazil

Received November 17, 2019
Accepted May 31, 2020

Corresponding author:
João Paolo Bilibio
Department of Obstetrics and Gynecology, Universidade Federal do Pará
Belém - PA- Brazil. E-mail: joaopaolobilibio@yahoo.com.br

CONFLICT OF INTEREST
The authors have no conflict of interest to declare.

ABSTRACT
Objective: The study looked into the possible influence of GDF9 polymorphisms on ovarian response in women with a normal ovarian reserve undergoing controlled ovarian hyperstimulation for in vitro fertilization (IVF).
Methods: This cross-sectional study included 67 women with normal ovarian reserve aged 30-39 years submitted to controlled ovarian hyperstimulation for IVF. We sequenced four polymorphisms in the GDF9 gene (C398G, C447T, G546A, and G646A) and analyzed their influence on follicular and oocyte outcomes.
Results: The mutant allele C398G decreased the total number of follicles >17mm (6.49 vs. 4.33, p=0.001), total number of follicles (10.11 vs. 7.33, p=0.032), number of MII oocytes retrieved, and serum progesterone levels on trigger day. The C447T polymorphism was associated with a greater number of follicles between 12 and 14 mm on the day of r-hCG, while the G546A polymorphism was associated with lower serum progesterone levels on trigger day.
Conclusions: GDF9 gene polymorphisms C398G and C447T adversely affected ovarian response in women undergoing controlled ovarian hyperstimulation. These findings show that in addition to playing a role in the early stages of folliculogenesis, GDF9 polymorphisms have an important impact on the final stage of oocyte development.

Keywords: GDF9, polymorphism, in vitro fertilization, oocyte, follicle retrieval

INTRODUCTION
In vitro fertilization is an efficient assisted reproduction technology used to treat infertility in women. One of the essential elements in successful IVF is the number of eggs produced following controlled ovarian hyperstimulation (COH) (van Loendersloot et al., 2014). Several factors regulate follicular growth and depletion; these include members of the transforming growth factor-β (TGFB) super family (Knight & Glister, 2006; Trombly et al., 2009; Pangas, 2012). GDF-9, a member of TGFB super family, is an oocyte-derived factor that is preferentially expressed in the oocytes of humans and mice (Chang et al., 2016) known to influence follicle growth and depletion rates (Simoni et al., 2008; Knight & Glister, 2006; Juengel & McNatty, 2005; Broekmans et al., 2009). GDF-9 genetic variants have been associated with abnormal follicular loss and potential premature ovarian failure (POF) (Broekmans et al., 2009).
GDF-9 contributes to ovarian folliculogenesis, a process that controls various granulosa cell processes and the ovulation rate. GDF-9 supports the proliferation of granulosa cells and the growth of cumulus cells, the halt of follicular apoptosis, and the growth of oocytes and embryos (Vitt et al., 2000; Yan et al., 2001; Orisaka et al., 2006; Yeo et al., 2008). Additionally, GDF9 stimulates granulosa cell proliferation (Vitt et al., 2000) and cumulus expansion (Yan et al., 2001), inhibits follicular apoptosis (Orisaka et al., 2006), and enhances oocyte and embryo development (Yeo et al., 2008; Hussein et al., 2006). Taken together, these findings suggest that disrupting the GDF9 gene may prevent folliculogenesis and oogenesis, resulting in ovarian failure. Consistent with these results, GDF9 mutations have been related to abnormal reproductive phenotypes in women, including POF (Hanrahan et al., 2004; Dixit et al., 2005; Chand et al., 2006), polycystic ovary syndrome (Sun et al., 2010; Wei et al., 2014), and dizygotic twinning (Palmer et al., 2006).
Single nucleotide polymorphisms (SNPs) of GDF-9 have been correlated with POF, suggesting that these variants may contribute to aberrant follicular development and oocyte loss (Chand et al., 2006; Laissue et al., 2006; Kovanci et al., 2007). Among the SNPs in the GDF9 gene that have been associated with infertility and POF (Kovanci et al., 2007), the most notable are C398-9G (Dixit et al., 2005), C447T (Dixit et al., 2005, Serdyńska-Szuster et al., 2016), G546A (Serdyńska-Szuster et al., 2016; Wang et al., 2010), and G646A (Dixit et al., 2005). Few studies regarding the association between GDF9 polymorphisms and controlled ovarian hyperstimulation (COH) outcomes have been published (Wang et al., 2010; 2013). The aim of this study was to investigate the possible influence of GDF9 polymorphisms (C398G, C477T, G546A, and G646A) on ovarian response in women with a normal ovarian reserve undergoing COH for IVF.

MATERIALS AND METHODS
This cross-sectional study included women aged 30-39 years undergoing COH based on an r-FSH and r-GnRH antagonist protocol sequenced for four polymorphisms of the GDF-9 gene (C398-9G, C447T, G546A and G646A). The study was carried out at the Pronatus Assisted Reproduction Center and at the Federal University of Rio Grande do Sul. The National Committee for Ethics and Research with Human Beings and the Ethics Committee of the Hospital de Clínicas de Porto Alegre approved the study and assigned it certificate no. 25525413.0.0000.5327 (Institutional Review Board equivalent).
A total of 67 women were included in the study. Since the study aimed to evaluate women with a normal ovarian reserve (NOR), the following inclusion criteria were used: age between 30 and 39 years, normal ovarian reserve (antral follicle count >5 (Broer et al., 2011), AMH >1.0ng/mL (Tal & Seifer, 2017) and FSH <8IU/L at 3rd of menstrual cycle (27), regular cycles, a diagnosis of infertility (more than one year) by tubal factor (confirmed by hysterosalpingography or videolaparoscopy) or by severe male factor (spermogram of <5 million sperm/ml). The following exclusion criteria were applied: polycystic ovary syndrome, presence of only one ovary or other previous ovarian surgery, previous chemotherapy or endometrioma. All patients were evaluated for ovarian reserve on the third day of the menstrual cycle based on antral follicle count (AFC) and FSH, LH, AMH, and E2 levels.
Ovarian stimulation was initiated on the third day of the menstrual cycle with recombinant FSH (Puregon, Organon) and included r-FSH 200 IU/day for the first three days and then 150 IU/day; after Day 6, a GnRH antagonist, Orgalutran (Organon), was administered daily by S.C. (0.25mg/d) until the administration of recombinant human chorionic gonadotropin (rhCG) (Ovidrel 250 mg/0.5ml, Serono). When the majority of the follicles reached 17 mm, oocyte maturation was stimulated with recombinant hCG and on this day all follicles were measured and serum FSH, LH and P4 levels were measured. Ultrasound-guided oocyte retrieval was performed after 35 h and, following denudation, the oocytes were categorized as metaphase II (MII), metaphase I (MI), or prophase I (PI) stage.
Whole blood samples were collected and aliquots of 350 µL from each sample were used for genomic DNA extraction using the Easy DNA kit according to manufacturer’s instructions (Invitrogen, UK). For analysis of the GDF-9 gene, the first portion of exon 2 was amplified by polymerase chain reaction (PCR) using the forward (5′ TTGACTTGACTGCCTGTTGTG 3′) and reverse primers (5′ AGCCTGAGCACTTGTGTCATT 3′) described by Kovanci et al. (2007) at an annealing temperature of 63°C. The DNA concentration used was 200 ng/µL (the product obtained was a 491-bp fragment). Amplification was performed using the Veriti® 96-Well Thermal Cycler (Applied Biosystems, USA) with reagents from Invitrogen (UK) and was confirmed by electrophoresis on 1.5% agarose gel. The 491-bp fragments were purified with PEG8000 and NaCl 2.5 M, and the samples were sequenced according to the Sanger method using an ABI 3500 Genetic Analyzer automated sequencer (Applied Biosystems, USA). The reverse primer was used for sequencing at a concentration of 4 pmol/µL, and the results were compared to the reference sequence from NCBI (NM_005260.3).
Observed numbers for each genotype studied (C398-9G, C447T, G546A, and G646A) were compared with expected values to test whether the sample was in the Hardy-Weinberg equilibrium. Data were tested for normality using the Kolmogorov-Smirnov test. Differences between groups for data with a normal distribution were evaluated with the t-test or one-way analysis of variance (ANOVA) and the Bonferroni post-hoc test when indicated. The Mann-Whitney and Kruskal-Wallis tests were used in the analysis of non-parametric data. Qualitative variables were analyzed with the Chi-square test. Statistical significance was set at <0.05. Statistical tests were performed with the Statistical Package for the Social Sciences 23 (SPSS Inc., Chicago, IL).

RESULTS
Demographic and clinical characteristics of the women included in the study are shown in Table 1. Their mean age was 35.3 years (SD 3.83) and they had been diagnosed with infertility for 4.2 years (SD 3.2). The Hardy-Weinberg equilibrium test results using the chi-square test for GDF9 polymorphisms were as follows: p=0.51 for C398G, p=0.33 for C447T, and p=0.74 for G546A; the women included in the study were homozygous for wild-type (GG) at position 649.

 

Table 1
Table 1. Demographic and clinical characteristics of women undergoing IVF

 

The influence of the C398G polymorphism in patients undergoing IVF is shown in Table 2 (two patients were excluded due to polymorphism sequencing failure). The presence of the mutant allele (C398G) was associated with a reduction in the total number of follicles >17mm on trigger day (6.49 vs. 4.33, p=0.001), a lower number of follicles (10.11 vs. 7.33, p=0.032), a lower number of MII oocytes retrieved (8.84 vs. 5.38, p=0.017), and lower serum progesterone levels on trigger day (0.96 vs. 0.47, p=0.003).

 

Table 2
Table 2. Influence of the C398G polymorphism of the GDF-9 gene in patients undergoing IVF

 

The results from the evaluation of the effects of C447T polymorphism in patients undergoing IVF are shown in Table 3 (one patient was excluded due to polymorphism sequencing failure). The presence of the mutant allele C447T significantly increased the number of follicles measuring 12-14 mm on trigger day (1.62 vs. 2.46, p=0.007).

 

Table 3
Table 3. Influence of the C447T polymorphism of the GDF-9 gene in patients undergoing IVF

 

The influence of the G546A polymorphism in patients undergoing IVF is shown in Table 4. The presence of the mutant allele G546A decreased serum progesterone levels on trigger day (0.92 vs. 0.53, p=0.025).

 

Table 4
Table 4. Influence of the G546A polymorphism of the GDF-9 gene in patients undergoing IVF

 

DISCUSSION
Previous studies have described the negative impacts of GDF9 polymorphisms on ovarian reserve leading to POF (Dixit et al., 2005; Chand et al., 2006). Since the present study included only patients with a normal ovarian reserve, it provided insight into the effects of GDF-9 polymorphisms on ovarian response to COH in these patients. In other words, it looked into whether these polymorphisms influence not only the ovarian reserve as previously described, but follicular growth as well. We found that the presence of some of the analyzed polymorphisms influenced follicular development or hormone production in some way. The presence of the C398G polymorphism was associated with a lower number of retrieved MII oocytes (8.8 versus 5.3), a lower number of total follicles on trigger day (10.1 versus 7.3), and lower levels of serum progesterone on trigger day (0.9 versus 0.4). The C447T polymorphism was associated with a greater number of follicles between 12 and 14 mm (1.6 versus 2.40), indicating it may impair follicular growth. The G546A polymorphism, such as C398G, has also been associated with lower levels of serum progesterone on trigger day (0.92 versus 0.53).
In vitro studies using recombinant GDF9 protein have clarified the biological roles and importance of GDF9 activity in follicle growth and development in all stages of folliculogenesis. In the preantral stage, GDF9 has been shown to stimulate the growth of in vitro cultured preantral follicles (Hayashi et al., 1999) and to promote growth of early-preantral follicles in human ovaries (Hreinsson et al., 2002). In the transition to the antral stage, it appears that GDF9 promotes follicular survival by suppressing granulosa cell apoptosis and follicular atresia (Orisaka et al., 2006). This may be achieved in part by GDF9 stimulating the expression of follicular FSH receptor (FSHR), since adequate FSHR levels in granulosa cells are essential for FSH-dependent antral-follicle growth. These mechanisms explain why the presence of some GDF-9 polymorphisms may influence the ovarian reserve, since they have been associated with diminished ovarian reserve (DOR), poor response after ovarian stimulation, and poor IVF outcome in studies comparing women with infertility and females with a normal ovarian reserve (Wang et al., 2010; 2013; Greene et al., 2014).
Published data further reinforce the findings of our study. GDF-9 has a role not only in follicular recruitment, but also in the entire process from follicle recruitment to oocyte maturation. We evaluated women with a normal ovarian reserve and no differences in the number of antral follicles; however, the presence of some GDF-9 polymorphisms resulted in altered follicular growth (C447T and C398G) and culminated in fewer retrieved MII oocytes (C398G) and fewer antral follicles.
Studies have demonstrated that many intra- and extra-ovarian factors, including FSH, LH and E2, play important roles in the development of follicles; however, paracrine signals derived from oocytes, including GDF9, seem to be the predominant determinants of the developmental state of follicles (Wei et al., 2014; Emori & Sugiura, 2014; Li et al., 2014). Prior to the LH surge, cumulus cells require GDF9 to support metabolic cascades, such as glycolysis and sterol biosynthesis (Sugiura et al., 2005). GDF9 also regulates diverse processes and gene expression during the preovulatory stage (Elvin et al., 2000) and enhances cumulus cell expansion in the presence of FSH (Elvin et al., 1999), but not in the absence of FSH (Dragovic et al., 2005). Beyond that, GDF-9 induces an EP2 signal transduction pathway, which appears to be required for progesterone synthesis in cumulus granulosa cells (Elvin et al., 2000). These mechanisms may explain the reason for the decrease in serum progesterone levels associated with the C447T and G546A polymorphisms. Failure of these mechanisms may decrease serum progesterone production, and cause or reflect failures in maturation and oocyte quality.
Importantly, the present study showed a negative association between GDF9 polymorphisms and follicular development in women with a normal ovarian reserve undergoing COH for IVF in an ethnically heterogeneous population. The findings suggested that GDF9 polymorphisms might be used as biomarkers in patients undergoing ovarian COH, since even in patients with a normal ovarian reserve the presence of these polymorphisms indicates a worse prognosis for COH. Additionally, women under gestational counseling may be advised to anticipate pregnancy if have these polymorphisms, since they may suffer with early ovarian reserve decreases.

CONCLUSION
We concluded that GDF9 gene polymorphisms (C398G, C477T, G546A) adversely affect ovarian response in women with a normal ovarian reserve undergoing COH for IVF. The presence of the C398G polymorphism was associated with a lower number of retrieved MII oocytes and a lower number of total follicles on r-hCG day. The C447T polymorphism was associated with a greater number of follicles between 12 and 14mm on the day of r-hCG, while the C398G and G546A polymorphisms were associated with lower levels of serum progesterone on r-hCG day. These data show that this member of the TGFB family functions in the early stages of folliculogenesis, causing DOR, and exerts an important influence on the final stage of oocyte development, even in patients with a normal ovarian reserve.

ACKNOWLEDGEMENT
We are grateful for the financial support provided by the Fundo de Incentivo à Pesquisa (FIPE), Hospital de Clínicas de Porto Alegre, Brazil.

REFERENCES
Broekmans FJ, Soules MR, Fauser BC. Ovarian aging: mechanisms and clinical consequences. Endocr Rev. 2009;30:465-93. PMID: 19589949 DOI: 10.1210/er.2009-0006
Medline Crossref

Broer SL, Dólleman M, Opmeer BC, Fauser BC, Mol BW, Broekmans FJ. AMH and AFC as predictors of excessive response in controlled ovarian hyperstimulation: a meta-analysis. Hum Reprod Update. 2011;17:46-54. PMID: 20667894 DOI: 10.1093/humupd/dmq034
Medline Crossref

Chand AL, Ponnampalam AP, Harris SE, Winship IM, Shelling AN. Mutational analysis of BMP15 and GDF9 as candidate genes for premature ovarian failure. Fertil Steril. 2006;86:1009-12. PMID: 17027369 DOI: 10.1016/j.fertnstert.2006.02.107
Medline Crossref

Chang HM, Qiao J, Leung PC. Oocyte-somatic cell interactions in the human ovary-novel role of bone morphogenetic proteins and growth differentiation factors. Hum Reprod Update. 2016;23:1-18. PMID: 27797914 DOI: 10.1093/humupd/dmw039
Medline Crossref

Dixit H, Rao LK, Padmalatha V, Kanakavalli M, Deenadayal M, Gupta N, Chakravarty B, Singh L. Mutational screening of the coding region of growth differentiation factor 9 gene in Indian women with ovarian failure. Menopause. 2005;12:749-54. PMID: 16278619 DOI: 10.1097/01.gme.0000184424.96437.7a
Medline Crossref

Dragovic RA, Ritter LJ, Schulz SJ, Amato F, Armstrong DT, Gilchrist RB. Role of oocyte-secreted growth differentiation factor 9 in the regulation of mouse cumulus expansion. Endocrinology. 2005;146:2798-806. PMID: 15761035 DOI: 10.1210/en.2005-0098
Medline Crossref

Elvin JA, Yan C, Wang P, Nishimori K, Matzuk MM. Molecular characterization of the follicle defects in the growth differentiation factor 9-deficient ovary. Mol Endocrinol. 1999;13:1018-34. PMID: 10379899 DOI: 10.1210/mend.13.6.0309
Medline Crossref

Elvin JA, Yan C, Matzuk MM. Growth differentiation factor-9 stimulates progesterone synthesis in granulosa cells via a prostaglandin E2/EP2 receptor pathway. Proc Natl Acad Sci U S A. 2000;97:10288-93. PMID: 10944203 DOI: 10.1073/pnas.180295197
Medline Crossref

Emori C, Sugiura K. Role of oocyte-derived paracrine factors in follicular development. Anim Sci J. 2014; 85:627-33. PMID: 24717179 DOI: 10.1111/asj.12200
Medline Crossref

Greene AD, Patounakis G, Segars JH. Genetic associations with diminished ovarian reserve: a systematic review of the literature. J Assist Reprod Genet. 2014;31:935-46. PMID: 24840722 DOI: 10.1007/s10815-014-0257-5
Medline Crossref

Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R, Galloway SM. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol Reprod. 2004;70:900-9. PMID: 14627550 DOI: 10.1095/biolreprod.103.023093
Medline Crossref

Hayashi M, McGee EA, Min G, Klein C, Rose UM, van Duin M, Hsueh AJ. Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology. 1999;140:1236-44. PMID: 10067849 DOI: 10.1210/endo.140.3.6548
Medline Crossref

Hreinsson JG, Scott JE, Rasmussen C, Swahn ML, Hsueh AJ, Hovatta O. Growth differentiation factor-9 promotes the growth, development, and survival of human ovarian follicles in organ culture. J Clin Endocrinol Metab. 2002;87:316-21. PMID: 11788667 DOI: 10.1210/jcem.87.1.8185
Medline Crossref

Hussein TS, Thompson JG, Gilchrist RB. Oocyte-secreted factors enhance oocyte developmental competence. Dev Biol. 2006;296:514-21. PMID: 16854407 DOI: 10.1016/j.ydbio.2006.06.026
Medline Crossref

Juengel JL, McNatty KP. The role of proteins of the transforming growth factor-beta superfamily in the intraovarian regulation of follicular development. Hum Reprod Update. 2005;11:143-60. PMID: 15705960 DOI: 10.1093/humupd/dmh061
Medline Crossref

Knight PG, Glister C. TGF-beta superfamily members and ovarian follicle development. Reproduction. 2006;132:191-206. PMID: 16885529 DOI: 10.1530/rep.1.01074
Medline Crossref

Kovanci E, Rohozinski J, Simpson JL, Heard MJ, Bishop CE, Carson SA. Growth differentiating factor-9 mutations may be associated with premature ovarian failure. Fertil Steril. 2007;87:143-6. PMID: 17156781 DOI: 10.1016/j.fertnstert.2006.05.079
Medline Crossref

Laissue P, Christin-Maitre S, Touraine P, Kuttenn F, Ritvos O, Aittomaki K, Bourcigaux N, Jacquesson L, Bouchard P, Frydman R, Dewailly D, Reyss AC, Jeffery L, Bachelot A, Massin N, Fellous M, Veitia RA. Mutations and sequence variants in GDF9 and BMP15 in patients with premature ovarian failure. Eur J Endocrinol. 2006;154:739-44. PMID: 16645022 DOI: 10.1530/eje.1.02135
Medline Crossref

Li Y, Li RQ, Ou SB, Zhang NF, Ren L, Wei LN, Zhang QX, Yang DZ. Increased GDF9 and BMP15 mRNA levels in cumulus granulosa cells correlate with oocyte maturation, fertilization, and embryo quality in humans. Reprod Biol Endocrinol. 2014;12:81. PMID: 25139161 DOI: 10.1186/1477-7827-12-81
Medline Crossref

Orisaka M, Orisaka S, Jiang JY, Craig J, Wang Y, Kotsuji F, Tsang BK. Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage. Mol Endocrinol. 2006;20:2456-68. PMID: 16740654 DOI: 10.1210/me.2005-0357
Medline Crossref

Palmer JS, Zhao ZZ, Hoekstra C, Hayward NK, Webb PM, Whiteman DC, Martin NG, Boomsma DI, Duffy DL, Montgomery GW. Novel variants in growth differentiation factor 9 in mothers of dizygotic twins. J Clin Endocrinol Metab. 2006;91:4713-6. PMID: 16954162 DOI: 10.1210/jc.2006-0970
Medline Crossref

Pangas SA. Regulation of the ovarian reserve by members of the transforming growth factor beta family. Mol Reprod Dev. 2012;79:666-79. PMID: 22847922 DOI: 10.1002/mrd.22076
Medline Crossref

Serdyńska-Szuster M, Jędrzejczak P, Ożegowska KE, Hołysz H, Pawelczyk L, Jagodziński PP. Effect of growth differentiation factor-9 C447T and G546A polymorphisms on the outcomes of in vitro fertilization. Mol Med Rep. 2016;13:4437-42. PMID: 27035733 DOI: 10.3892/mmr.2016.5060
Medline Crossref

Simoni M, Tempfer CB, Destenaves B, Fauser BC. Functional genetic polymorphisms and female reproductive disorders: Part I: Polycystic ovary syndrome and ovarian response. Hum Reprod Update. 2008;14:459-84. PMID: 18603647 DOI: 10.1093/humupd/dmn024
Medline Crossref

Sugiura K, Pendola FL, Eppig JJ. Oocyte control of metabolic cooperativity between oocytes and companion granulosa cells: energy metabolism. Dev Biol. 2005;279:20-30. PMID: 15708555 DOI: 10.1016/j.ydbio.2004.11.027
Medline Crossref

Sun RZ, Lei L, Cheng L, Jin ZF, Zu SJ, Shan ZY, Wang ZD, Zhang JX, Liu ZH. Expression of GDF-9, BMP-15 and their receptors in mammalian ovary follicles. J Mol Histol. 2010;41:325-32. PMID: 20857181 DOI: 10.1007/s10735-010-9294-2
Medline Crossref

Tal R, Seifer DB. Ovarian reserve testing: a user's guide. Am J Obstet Gynecol. 2017;217:129-40. PMID: 28235465 DOI: 10.1016/j.ajog.2017.02.027
Medline Crossref

Trombly DJ, Woodruff TK, Mayo KE. Roles for transforming growth factor beta superfamily proteins in early folliculogenesis. Semin Reprod Med. 2009;27:14-23. PMID: 19197801 DOI: 10.1055/s-0028-1108006
Medline Crossref

van Loendersloot L, Repping S, Bossuyt PM, van der Veen F, van Wely M. Prediction models in in vitro fertilization; where are we? A mini review. J Adv Res. 2014;5:295-301. PMID: 25685496 DOI: 10.1016/j.jare.2013.05.002
Medline Crossref

Vitt UA, Hayashi M, Klein C, Hsueh AJ. Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biol Reprod. 2000;62:370-7. PMID: 10642575 DOI: 10.1095/biolreprod62.2.370
Medline Crossref

Wang TT, Wu YT, Dong MY, Sheng JZ, Leung PC, Huang HF. G546A polymorphism of growth differentiation factor-9 contributes to the poor outcome of ovarian stimulation in women with diminished ovarian reserve. Fertil Steril. 2010;94:2490-2. PMID: 20451184 DOI: 10.1016/j.fertnstert.2010.03.070
Medline Crossref

Wang TT, Ke ZH, Song Y, Chen LT, Chen XJ, Feng C, Zhang D, Zhang RJ, Wu YT, Zhang Y, Sheng JZ, Huang HF. Identification of a mutation in GDF9 as a novel cause of diminished ovarian reserve in young women. Hum Reprod. 2013;28:2473-81. PMID: 23851219 DOI: 10.1093/humrep/det291
Medline Crossref

Wei LN, Huang R, Li LL, Fang C, Li Y, Liang XY. Reduced and delayed expression of GDF9 and BMP15 in ovarian tissues from women with polycystic ovary syndrome. J Assist Reprod Genet. 2014;31:1483-90. PMID: 25172094 DOI: 10.1007/s10815-014-0319-8
Medline Crossref

Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV, Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol Endocrinol. 2001;15:854-66. PMID: 11376106 DOI: 10.1210/mend.15.6.0662
Medline Crossref

Yeo CX, Gilchrist RB, Thompson JG, Lane M. Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Hum Reprod. 2008;23:67-73. PMID: 17933754 DOI: 10.1093/humrep/dem140
Medline Crossref